 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato sRNA S11221210
| Sequence | Length | annotation |
|---|---|---|
| AUGGGGGAACAGAGUAUUUGAAGC | 24 |
expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 2 | 0.51 |
S11221210 mapped to the follwoing genes
| gene ID | start position | stop position | strand | expression |
|---|---|---|---|---|
| Solyc00g266110 | 116 | 139 | + | click here |
| Solyc00g322630 | 116 | 139 | + | click here |
| Solyc10g009610 | 116 | 139 | + | click here |
| Solyc10g009640 | 179 | 202 | + | click here |
| Solyc10g011650 | 119 | 142 | + | click here |
| Solyc10g011660 | 128 | 151 | + | click here |