Tomato sRNA S11284979
| Sequence | Length | annotation |
| AUGUAAGGAUAUGACACAUGAGCC | 24 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
7 |
0.68 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
3 |
0.4 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
9 |
1.05 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
73 |
15.72 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
3 |
0.22 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
1 |
0.77 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
3 |
1.87 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
4 |
2.55 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
3 |
1.98 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
1 |
0.98 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
4 |
2.34 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
6 |
5.89 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
2 |
2.18 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
1 |
1.33 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1 |
0.26 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1 |
0.48 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
4 |
2.27 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
3 |
0.93 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
6 |
1.58 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
26 |
7.78 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
50 |
15.13 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
8 |
2.41 |
|