Tomato sRNA S13318188
| Sequence | Length | annotation |
|---|
| CAUGGCAGGAAGACAUGAGGCAUU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
4 |
0.86 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
167 |
128.69 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
63 |
47.79 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
73 |
52.01 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
103 |
75.86 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
172 |
107.4 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
134 |
85.36 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
97 |
63.93 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
153 |
93.54 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
287 |
171.8 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
43 |
41.96 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
169 |
98.66 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
44 |
43.16 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
104 |
73.55 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
18 |
19.59 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
109 |
75.93 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
94 |
125.44 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
4 |
1.67 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
11 |
11.25 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
13 |
3.27 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
15 |
4.25 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
33 |
8.44 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
121 |
58.29 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
102 |
84.74 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
164 |
92.99 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
36 |
11.11 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
263 |
69.04 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3 |
0.91 |
S13318188 mapped to the following genes
|
