Tomato sRNA S13524470
| Sequence | Length | annotation |
| CCAUCACGAUGUAGGCUCAGGC | 22 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
133 |
12.96 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
27 |
3.58 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
10 |
1.17 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
14 |
3.01 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
7 |
0.52 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1 |
0.42 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
5 |
1.26 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
9 |
2.55 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1 |
0.26 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1 |
0.48 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
4 |
3.32 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
11 |
6.24 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
1 |
0.26 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
2 |
0.6 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
5 |
1.51 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2 |
0.6 |
|