Tomato sRNA S14429049
| Sequence | Length | annotation |
| CUAUGAGAUAAGUUCAACGUG | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
3017 |
293.99 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1419 |
188.08 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1705 |
199.18 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
673 |
144.93 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
5137 |
378.9 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
5 |
2.09 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
2 |
2.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
14 |
3.52 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
4 |
1.13 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
11 |
2.81 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2 |
1.66 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
14 |
7.94 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
28 |
8.64 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
41 |
10.76 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
417 |
124.81 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
177 |
53.57 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
419 |
126.26 |
|