Tomato sRNA S14956633
| Sequence | Length | annotation |
|---|
| CUUGGACUGAAGGGAGCUCCCU | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
165 |
127.15 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
10 |
7.59 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
3 |
2.14 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
23 |
16.94 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
18 |
11.24 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
36 |
22.93 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
92 |
60.63 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
84 |
51.35 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
104 |
62.26 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
10 |
9.76 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
10 |
5.84 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
4 |
3.92 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
3 |
2.12 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
145 |
157.85 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
98 |
93.63 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
44 |
127.1 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
53 |
36.92 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
77 |
102.75 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
3 |
0.85 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1 |
0.48 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
13 |
7.37 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1 |
0.31 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
42 |
11.03 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
|
