Tomato sRNA S17731097
| Sequence | Length | annotation |
| GGAAUCUUGAUGAUGCUGCAG | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
58 |
5.65 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
234 |
31.02 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
14 |
1.64 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1 |
0.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1 |
0.25 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
4 |
1.02 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
8 |
3.85 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
21 |
11.91 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
244 |
75.28 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
85 |
22.31 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
18 |
5.39 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
544 |
164.64 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
17 |
5.12 |
|