Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
GGCAUAUGUCAAGUAUUAUGG	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	11	1.46
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	572	66.82
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	29	6.24
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	208	15.34
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	190	79.45
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	27	27.61
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	288	72.49
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	23	6.52
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	1171	299.59
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	179	86.22
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	49	40.71
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	58	32.89
S0708	Solanum lycopersicum	MicroTom	flower, open	718	221.53
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	724	190.07
S0373	Solanum lycopersicum	Heinz 1706	fruit	24	7.18
S0372	Solanum lycopersicum	Heinz 1706	flower	21	6.36
S0371	Solanum lycopersicum	Heinz 1706	leaf	51	15.37