TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S18230750

SequenceLengthannotation
GGGAUGUUGUCUGGCUCGACA21

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 373 36.35
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 153 20.28
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 485 56.66
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 78 16.8
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 28 2.07
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 1 0.42
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 2 0.5
S0712 Solanum lycopersicum MicroTom fruit , mature green 3 0.77
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 7 3.37
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 2 1.66
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 10 5.67
S0708 Solanum lycopersicum MicroTom flower, open 3 0.93
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 16 4.2
S0373 Solanum lycopersicum Heinz 1706 fruit 1 0.3
S0372 Solanum lycopersicum Heinz 1706 flower 9 2.72
S0371 Solanum lycopersicum Heinz 1706 leaf 1 0.3

S18230750 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc01g104150 35 55 + click here