Tomato sRNA S18230750
| Sequence | Length | annotation |
| GGGAUGUUGUCUGGCUCGACA | 21 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
373 |
36.35 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
153 |
20.28 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
485 |
56.66 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
78 |
16.8 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
28 |
2.07 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1 |
0.42 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2 |
0.5 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
3 |
0.77 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
7 |
3.37 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2 |
1.66 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
10 |
5.67 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
3 |
0.93 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
16 |
4.2 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
9 |
2.72 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
S18230750 mapped to the following genes
|