Tomato sRNA S19186048
| Sequence | Length | annotation |
|---|
| GUCCAAGAAAGCUGUGGGAAA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
19 |
1.85 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
24 |
3.18 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1491 |
174.18 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
29 |
6.24 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
27 |
1.99 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1 |
0.25 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
3 |
0.77 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
28 |
13.49 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
11 |
9.14 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
6 |
3.4 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
3 |
0.93 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
11 |
2.89 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
6 |
1.8 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
13 |
3.93 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
3 |
0.9 |
|
