Tomato sRNA S19943155
| Sequence | Length | annotation |
| GUUGACGGCGUUAGAUUGAUAUA | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
24 |
1.77 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
453 |
349.09 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
298 |
226.06 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
258 |
183.81 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
321 |
236.41 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
643 |
401.49 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
333 |
212.14 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
405 |
266.92 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
418 |
255.54 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
386 |
231.06 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
268 |
261.49 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
515 |
300.64 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
204 |
200.11 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
380 |
268.75 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
496 |
539.95 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
674 |
643.98 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
393 |
1135.27 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
580 |
404.05 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
584 |
779.31 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
199 |
83.21 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
43 |
43.97 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
185 |
46.57 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
260 |
73.69 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
296 |
75.73 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
44 |
21.19 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
31 |
25.75 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
16 |
9.07 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
100 |
30.85 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
177 |
46.47 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
2 |
0.6 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|