Tomato sRNA S20528511
| Sequence | Length | annotation |
| UAAGGAUAUGACACAUGAGC | 20 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
5 |
0.49 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
1 |
0.77 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
1 |
0.71 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
1 |
0.64 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
5 |
3.3 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
1 |
0.61 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
2 |
1.2 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
1 |
0.98 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
2 |
1.17 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
6 |
5.89 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
3 |
4 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2 |
0.5 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
8 |
2.05 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
8 |
3.85 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
5 |
4.15 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
22 |
12.47 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
11 |
3.39 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
25 |
6.56 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|