Tomato sRNA S21066129
| Sequence | Length | annotation |
| UAGAUGUGCAUACUCAAAGUU | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
5 |
0.49 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
10 |
1.33 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
39 |
4.56 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1236 |
91.17 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
254 |
195.74 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
415 |
314.82 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
350 |
249.35 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
236 |
173.81 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
283 |
176.71 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
275 |
175.19 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
243 |
160.15 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
266 |
162.62 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
190 |
113.74 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
287 |
280.03 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
436 |
254.52 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
236 |
231.5 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
330 |
233.39 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
175 |
190.51 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
8 |
7.64 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
6 |
17.33 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
204 |
142.11 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
182 |
242.87 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
44 |
18.4 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
6 |
6.14 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
50 |
12.59 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
7 |
1.98 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
39 |
9.98 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
5 |
2.41 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
17 |
9.64 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
157 |
48.44 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
125 |
32.82 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
329 |
98.47 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
377 |
114.1 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
521 |
157 |
|