Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UCGAUAAACCUCUGCAUCCAG	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	6260	610
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	2034	269.6
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	4429	517.41
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	3353	722.04
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	8013	591.04
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	71	29.69
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	28	28.63
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	405	101.94
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	103	29.19
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	475	121.52
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	132	63.58
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	39	32.4
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	102	57.83
S0708	Solanum lycopersicum	MicroTom	flower, open	227	70.04
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	253	66.42
S0373	Solanum lycopersicum	Heinz 1706	fruit	2230	667.47
S0372	Solanum lycopersicum	Heinz 1706	flower	1654	500.57
S0371	Solanum lycopersicum	Heinz 1706	leaf	4164	1254.79