Tomato sRNA S22423035
| Sequence | Length | annotation |
| UCGCUUGGUGCAGGUCGGGAC | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
2862 |
278.89 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1169 |
154.95 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
346 |
40.42 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1186 |
255.4 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
157589 |
11623.8 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
650 |
271.81 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
116 |
118.62 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1161 |
292.23 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
375 |
106.28 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1066 |
272.73 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
968 |
466.28 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
388 |
322.33 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
625 |
354.38 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
536 |
165.38 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
808 |
212.12 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1483 |
443.88 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1544 |
467.28 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
8707 |
2623.78 |
S22423035 mapped to the following genes
|