TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S22423035

SequenceLengthannotation
UCGCUUGGUGCAGGUCGGGAC21miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 2862 278.89
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1169 154.95
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 346 40.42
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 1186 255.4
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 157589 11623.8
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 650 271.81
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 116 118.62
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 1161 292.23
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 375 106.28
S0712 Solanum lycopersicum MicroTom fruit , mature green 1066 272.73
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 968 466.28
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 388 322.33
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 625 354.38
S0708 Solanum lycopersicum MicroTom flower, open 536 165.38
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 808 212.12
S0373 Solanum lycopersicum Heinz 1706 fruit 1483 443.88
S0372 Solanum lycopersicum Heinz 1706 flower 1544 467.28
S0371 Solanum lycopersicum Heinz 1706 leaf 8707 2623.78

S22423035 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc08g005690 118 138 - click here