Tomato sRNA S22433644
| Sequence | Length | annotation |
| UCGGACCAGGCUUCAUUCCC | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
8 |
0.78 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
8 |
1.06 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
252 |
29.44 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
853 |
183.69 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1840 |
135.72 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
140 |
107.89 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
84 |
63.72 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
48 |
34.2 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
57 |
41.98 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
119 |
74.3 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
114 |
72.62 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
100 |
65.91 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
119 |
72.75 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
86 |
51.48 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
124 |
120.99 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
245 |
143.02 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
180 |
176.57 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
252 |
178.22 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
40 |
43.54 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
63 |
60.19 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
61 |
176.21 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
40 |
27.87 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
62 |
82.73 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
44 |
18.4 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
13 |
13.29 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
280 |
70.48 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
53 |
15.02 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
368 |
94.15 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
963 |
463.88 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
283 |
235.1 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
308 |
174.64 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
63 |
19.44 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
136 |
35.7 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
542 |
162.23 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
771 |
233.34 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
713 |
214.86 |
S22433644 mapped to the following genes
|