TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S22433644

SequenceLengthannotation
UCGGACCAGGCUUCAUUCCC20miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 8 0.78
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 8 1.06
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 252 29.44
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 853 183.69
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 1840 135.72
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 140 107.89
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 84 63.72
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 48 34.2
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 57 41.98
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 119 74.3
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 114 72.62
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 100 65.91
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 119 72.75
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 86 51.48
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 124 120.99
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 245 143.02
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 180 176.57
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 252 178.22
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 40 43.54
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 63 60.19
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 61 176.21
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 40 27.87
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 62 82.73
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 44 18.4
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 13 13.29
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 280 70.48
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 53 15.02
S0712 Solanum lycopersicum MicroTom fruit , mature green 368 94.15
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 963 463.88
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 283 235.1
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 308 174.64
S0708 Solanum lycopersicum MicroTom flower, open 63 19.44
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 136 35.7
S0373 Solanum lycopersicum Heinz 1706 fruit 542 162.23
S0372 Solanum lycopersicum Heinz 1706 flower 771 233.34
S0371 Solanum lycopersicum Heinz 1706 leaf 713 214.86

S22433644 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc08g083150 113 132 + click here