Tomato sRNA S22848263
| Sequence | Length | annotation |
|---|
| UCUUUCCUACUCCUCCCAUA | 20 | |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
3 |
0.4 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
5 |
0.58 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
11 |
0.81 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
6 |
4.62 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
12 |
9.1 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
8 |
5.7 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
4 |
2.95 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
6 |
3.75 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
10 |
6.37 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
4 |
2.64 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
6 |
3.67 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
2 |
1.2 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
14 |
13.66 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
29 |
16.93 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
22 |
21.58 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
24 |
16.97 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
5 |
5.44 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
11 |
10.51 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
5 |
14.44 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
6 |
4.18 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
5 |
6.67 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1 |
0.25 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1 |
0.26 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
9 |
4.34 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
4 |
3.32 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1 |
0.31 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
2 |
0.53 |
|
