Tomato sRNA S23003515
| Sequence | Length | annotation |
| UGAAGCUGCCAGCAUGAUCUA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
76 |
7.41 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
25 |
3.31 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
741 |
86.57 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
333 |
71.71 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
80413 |
5931.25 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
3087 |
2378.89 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
2307 |
1750.1 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
2005 |
1428.44 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
1207 |
888.93 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
2235 |
1395.55 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
1311 |
835.16 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
1207 |
795.47 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
1297 |
792.92 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
1532 |
917.08 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
4266 |
4162.34 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
5921 |
3456.52 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
4631 |
4542.71 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
4535 |
3207.3 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
2863 |
3116.67 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
3957 |
3780.74 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
1029 |
2972.5 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
2106 |
1467.13 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
1089 |
1453.2 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
20 |
8.36 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
9 |
9.2 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
101 |
25.42 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
7 |
1.98 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
323 |
82.64 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
133 |
64.07 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
34 |
28.25 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
166 |
94.12 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
2971 |
916.68 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
2518 |
661.04 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
85 |
25.44 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
8042 |
2433.84 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
4838 |
1457.89 |
|