Tomato sRNA S23042497
| Sequence | Length | annotation |
| UGAAUCCUUCGGCUAUCCAU | 20 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
3 |
0.65 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
192 |
14.16 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
7 |
2.93 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
2 |
2.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
16 |
4.03 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
31 |
7.93 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
48 |
23.12 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
22 |
18.28 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
47 |
26.65 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
41 |
12.65 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
18 |
4.73 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
15 |
4.49 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
7 |
2.12 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
4 |
1.21 |
|