Tomato sRNA S23042499
| Sequence | Length | annotation |
| UGAAUCCUUCGGCUAUCCAUAA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
124 |
12.08 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
82 |
10.87 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
633 |
73.95 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
99 |
21.32 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
16392 |
1209.07 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
628 |
262.61 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
160 |
163.61 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2531 |
637.07 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
615 |
174.31 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
3667 |
938.17 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1029 |
495.67 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
395 |
328.14 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1308 |
741.64 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
8334 |
2571.41 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
1819 |
477.54 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
2623 |
785.1 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1737 |
525.69 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
834 |
251.32 |
|