Tomato sRNA S23094736
| Sequence | Length | annotation |
| UGACAGAAGAGAGUGAGCACA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
51 |
3.76 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
18 |
13.87 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
14 |
10.62 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
14 |
9.97 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
14 |
10.31 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
16 |
9.99 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
10 |
6.37 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
13 |
8.57 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
24 |
14.67 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
23 |
13.77 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
79 |
77.08 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
28 |
16.35 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
19 |
18.64 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
17 |
12.02 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
33 |
35.92 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
25 |
23.89 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
58 |
167.55 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
13 |
9.06 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
55 |
73.39 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
2 |
0.84 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
4 |
4.09 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
11 |
2.77 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
7 |
1.79 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
5 |
2.41 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2 |
1.66 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4 |
1.23 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
5 |
1.31 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
2 |
0.6 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3 |
0.91 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
5 |
1.51 |
|