Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UGACAGAAGAUAGAGAGCAC	20	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	12	1.17
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	7	0.93
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	4	0.47
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	7	1.51
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	3510	258.9
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	23	9.62
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	4	4.09
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	255	64.18
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	47	13.32
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	455	116.41
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	127	61.18
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	38	31.57
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	39	22.11
S0708	Solanum lycopersicum	MicroTom	flower, open	56	17.28
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	970	254.65
S0373	Solanum lycopersicum	Heinz 1706	fruit	90	26.94
S0372	Solanum lycopersicum	Heinz 1706	flower	420	127.11
S0371	Solanum lycopersicum	Heinz 1706	leaf	1497	451.11