Tomato sRNA S23646567
| Sequence | Length | annotation |
| UGGACUGAAGGGAGCUCCCU | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
942 |
725.92 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
56 |
42.48 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
17 |
12.11 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
249 |
183.38 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
49 |
30.6 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
230 |
146.52 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
605 |
398.73 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
607 |
371.09 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
522 |
312.48 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
69 |
67.32 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
85 |
49.62 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
6 |
5.89 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
9 |
6.37 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
1187 |
1292.17 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
1004 |
959.28 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
320 |
924.39 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
494 |
344.14 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
289 |
385.65 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2 |
1.66 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
366 |
96.08 |
|