Tomato sRNA S23655831
| Sequence | Length | annotation |
| UGGAGAAGCAGGGCACGUGCAA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
12 |
1.59 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
8 |
0.93 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
268 |
112.07 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
43 |
43.97 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
294 |
74 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
92 |
26.07 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
14 |
3.58 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
60 |
28.9 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
7 |
5.82 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
17 |
9.64 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
89 |
27.46 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
52 |
13.65 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
13 |
3.89 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
8 |
2.42 |
|