Tomato sRNA S23676315
| Sequence | Length | annotation |
| UGGAGGCAGCGGUUCAUCGAUC | 22 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
221 |
21.54 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
148 |
19.62 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
61 |
7.13 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
11 |
2.37 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
297 |
21.91 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
34 |
14.22 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
5 |
5.11 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
39 |
9.82 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
18 |
5.1 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
67 |
17.14 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
11 |
5.3 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
7 |
5.82 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
11 |
6.24 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
77 |
23.76 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
25 |
6.56 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
20 |
5.99 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
21 |
6.36 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
31 |
9.34 |
|