Tomato sRNA S23946472
| Sequence | Length | annotation |
|---|
| UGUAAGGAUAUGACACAUGAGC | 22 | |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
5 |
3.85 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
4 |
3.03 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
3 |
2.14 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
2 |
1.47 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
8 |
5 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
2 |
1.27 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
4 |
2.64 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
3 |
1.83 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
4 |
2.39 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
4 |
3.9 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
4 |
2.34 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
13 |
12.75 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
2 |
2.18 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
4 |
2.79 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
12 |
16.01 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1 |
0.25 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1 |
0.48 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2 |
1.13 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
|
