Tomato sRNA S24684376
| Sequence | Length | annotation |
|---|
| UUAGUAUAGUAUAAGUGUGUCUC | 23 | |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
51 |
4.97 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
14 |
1.86 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
14 |
1.64 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
48 |
3.54 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
1 |
0.74 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
1 |
0.62 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
1 |
0.58 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
2 |
1.41 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
1 |
1.09 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2 |
0.5 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
2 |
0.51 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
6 |
3.4 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1 |
0.31 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
17 |
4.46 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
36 |
10.78 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
13 |
3.93 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
15 |
4.52 |
|
