Tomato sRNA S24684381
| Sequence | Length | annotation |
| UUAGUAUAGUAUAAGUGUGUCUCU | 24 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1105 |
107.68 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
456 |
60.44 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
93 |
10.86 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
15 |
3.23 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
346 |
25.52 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
7 |
5.39 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
5 |
3.79 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
4 |
2.95 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
8 |
5 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
10 |
6.37 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
1 |
0.66 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
7 |
4.28 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
1 |
0.6 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
4 |
3.9 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
23 |
13.43 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
11 |
10.79 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
10 |
7.07 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
12 |
13.06 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
5 |
4.78 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
1 |
2.89 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
24 |
16.72 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
2 |
2.67 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
5 |
2.09 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
7 |
1.76 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
3 |
0.85 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
14 |
3.58 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
7 |
3.37 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
5 |
4.15 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
14 |
7.94 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
6 |
1.85 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
50 |
13.13 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
230 |
68.84 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
116 |
35.11 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
87 |
26.22 |
|