Tomato sRNA S24937335
| Sequence | Length | annotation |
| UUCAAUAAAGCUGUGGGAAG | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1399 |
136.33 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
784 |
103.92 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
430 |
50.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
652 |
140.4 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
118 |
8.7 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
20 |
15.41 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
55 |
41.72 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
25 |
17.81 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
43 |
31.67 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
92 |
57.45 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
26 |
16.56 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
65 |
42.84 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
64 |
39.13 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
32 |
19.16 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
18 |
17.56 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
25 |
14.59 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
35 |
34.33 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
12 |
8.49 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
64 |
69.67 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
92 |
87.9 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
24 |
69.33 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
16 |
11.15 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
18 |
24.02 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
7 |
2.93 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
1 |
1.02 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
39 |
9.82 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
9 |
2.55 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
21 |
5.37 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
32 |
15.41 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
5 |
4.15 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1 |
0.31 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
13 |
3.41 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
106 |
31.73 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
42 |
12.71 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
126 |
37.97 |
|