Tomato sRNA S25045576
| Sequence | Length | annotation |
| UUCCACAGCUUUCUUGAACU | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
576 |
56.13 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
264 |
34.99 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
830 |
96.96 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
4179 |
899.92 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
55 |
4.06 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
8 |
6.16 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
9 |
6.83 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
3 |
2.14 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
14 |
10.31 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
18 |
11.24 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
12 |
7.64 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
24 |
15.82 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
8 |
4.89 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
5 |
2.99 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
24 |
23.42 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
27 |
15.76 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
35 |
34.33 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
29 |
20.51 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
17 |
18.51 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
18 |
17.2 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
5 |
14.44 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
9 |
6.27 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
5 |
6.67 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
8 |
3.35 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
6 |
6.14 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
11 |
2.77 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
14 |
3.97 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
34 |
8.7 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
36 |
17.34 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
6 |
4.98 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
12 |
6.8 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
27 |
8.33 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
20 |
5.25 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
23 |
6.88 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
21 |
6.36 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
19 |
5.73 |
|