Tomato sRNA S25045577
| Sequence | Length | annotation |
| UUCCACAGCUUUCUUGAACUG | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
8555 |
833.64 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
3913 |
518.65 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
442097 |
51646.7 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
65614 |
14129.5 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1379 |
101.71 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
110 |
84.77 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
129 |
97.86 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
49 |
34.91 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
56 |
41.24 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
128 |
79.92 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
78 |
49.69 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
139 |
91.61 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
163 |
99.65 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
83 |
49.68 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
187 |
182.46 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
282 |
164.62 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
210 |
206 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
182 |
128.72 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
167 |
181.8 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
183 |
174.85 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
49 |
141.55 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
69 |
48.07 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
48 |
64.05 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
22 |
9.2 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
10 |
10.23 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
115 |
28.95 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
30 |
8.5 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
233 |
59.61 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
38 |
18.3 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
16 |
13.29 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2 |
1.13 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
67 |
20.67 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
60 |
15.75 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
4329 |
1295.73 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
608 |
184.01 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1538 |
463.46 |
|