Tomato sRNA S25045581
| Sequence | Length | annotation |
| UUCCACAGCUUUCUUGAACUU | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1088 |
106.02 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
482 |
63.89 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
9616 |
1123.36 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
7772 |
1673.65 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
389 |
28.69 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
123 |
94.79 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
140 |
106.2 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
81 |
57.71 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
78 |
57.45 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
267 |
166.72 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
166 |
105.75 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
186 |
122.58 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
139 |
84.98 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
88 |
52.68 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
356 |
347.35 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
597 |
348.51 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
584 |
572.87 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
567 |
401 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
344 |
374.48 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
372 |
355.43 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
87 |
251.32 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
289 |
201.33 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
124 |
165.47 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
10 |
4.18 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
12 |
12.27 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
55 |
13.84 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
28 |
7.94 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
98 |
25.07 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
42 |
20.23 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
5 |
4.15 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
11 |
6.24 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
39 |
12.03 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
236 |
61.96 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
432 |
129.3 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
402 |
121.66 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
376 |
113.3 |
|