Tomato sRNA S25121238
| Sequence | Length | annotation |
| UUCGGACCAGGCUUCAUUCCC | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
23 |
2.24 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
13 |
1.72 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
126 |
14.72 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
941 |
202.64 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
5489 |
404.87 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
371 |
285.9 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
270 |
204.82 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
177 |
126.1 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
156 |
114.89 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
366 |
228.53 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
248 |
157.99 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
250 |
164.76 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
333 |
203.58 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
322 |
192.75 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
320 |
312.22 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
849 |
495.62 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
333 |
326.65 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
1154 |
816.15 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
482 |
524.71 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
585 |
558.94 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
263 |
759.74 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
136 |
94.74 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
229 |
305.59 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
71 |
29.69 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
20 |
20.45 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
390 |
98.16 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
42 |
11.9 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
394 |
100.8 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
106 |
51.06 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
40 |
33.23 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
30 |
17.01 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
484 |
149.34 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
332 |
87.16 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1226 |
366.96 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1355 |
410.08 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
3077 |
927.23 |
|