Tomato sRNA S25121239
| Sequence | Length | annotation |
| UUCGGACCAGGCUUCAUUCCCC | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
8 |
0.93 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
74 |
15.94 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
204 |
15.05 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
17 |
13.1 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
23 |
17.45 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
13 |
9.26 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
6 |
4.42 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
15 |
9.37 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
18 |
11.47 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
19 |
12.52 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
13 |
7.95 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
12 |
7.18 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
27 |
26.34 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
95 |
55.46 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
37 |
36.29 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
107 |
75.67 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
60 |
65.32 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
80 |
76.44 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
52 |
150.21 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
9 |
6.27 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
43 |
57.38 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
7 |
2.93 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
4 |
4.09 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
35 |
8.81 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
14 |
3.97 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
60 |
15.35 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
9 |
4.34 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
7 |
5.82 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
3 |
1.7 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
155 |
47.82 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
30 |
7.88 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
48 |
14.37 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
104 |
31.47 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
114 |
34.35 |
|