Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUGACAGAAGAUAGAGAGCA	20	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	19	1.85
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	12	1.59
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	3	0.35
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	43	9.26
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	3132	231.02
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	45	18.82
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	3	3.07
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	401	100.93
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	31	8.79
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	890	227.7
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	929	447.5
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	267	221.81
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	416	235.87
S0708	Solanum lycopersicum	MicroTom	flower, open	532	164.15
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	1496	392.74
S0373	Solanum lycopersicum	Heinz 1706	fruit	76	22.75
S0372	Solanum lycopersicum	Heinz 1706	flower	191	57.8
S0371	Solanum lycopersicum	Heinz 1706	leaf	2561	771.74