Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUGACAGAAGAUAGAGAGCAC	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	2515	245.07
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1856	246
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	142	16.59
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	400	86.14
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	396342	29234.2
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	1518	634.77
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	280	286.31
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	5943	1495.88
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	938	265.85
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	13239	3387.06
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	3131	1508.2
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	989	821.6
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	1655	938.39
S0708	Solanum lycopersicum	MicroTom	flower, open	8784	2710.25
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	25769	6765.06
S0373	Solanum lycopersicum	Heinz 1706	fruit	9015	2698.32
S0372	Solanum lycopersicum	Heinz 1706	flower	22461	6797.64
S0371	Solanum lycopersicum	Heinz 1706	leaf	219457	66131.5