Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUGACAGAAGAUAGAGAGCACA	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	196	14.46
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	4	1.67
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	10	2.52
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	30	7.68
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	252	121.39
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	133	110.49
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	179	101.49
S0708	Solanum lycopersicum	MicroTom	flower, open	92	28.39
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	111	29.14
S0373	Solanum lycopersicum	Heinz 1706	fruit	8	2.39
S0372	Solanum lycopersicum	Heinz 1706	flower	24	7.26
S0371	Solanum lycopersicum	Heinz 1706	leaf	139	41.89