Tomato sRNA S25581452
| Sequence | Length | annotation |
|---|
| UUGGACUGAAGGGAGCUCCC | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
7 |
0.82 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
83 |
17.87 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
400 |
308.25 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
33 |
25.03 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
9 |
6.41 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
75 |
55.24 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
31 |
19.36 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
186 |
118.49 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
240 |
158.17 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
221 |
135.11 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
289 |
173 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
17 |
16.59 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
28 |
16.35 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
7 |
6.87 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
9 |
6.37 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
225 |
244.94 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
114 |
108.92 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
83 |
239.76 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
78 |
54.34 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
97 |
129.44 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
5 |
1.26 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
9 |
4.34 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
17 |
9.64 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
13 |
4.01 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
352 |
92.41 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
|
