Tomato sRNA S25581453
| Sequence | Length | annotation |
| UUGGACUGAAGGGAGCUCCCU | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
8 |
0.93 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
22 |
4.74 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1 |
0.07 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
8551 |
6589.53 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
423 |
320.89 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
131 |
93.33 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
1261 |
928.7 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
477 |
297.84 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
1848 |
1177.25 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
3615 |
2382.47 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
3849 |
2353.07 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
4436 |
2655.45 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
266 |
259.54 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
646 |
377.12 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
104 |
102.02 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
55 |
38.9 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
6048 |
6583.87 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
3971 |
3794.12 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
2262 |
6534.31 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
2082 |
1450.41 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
2513 |
3353.43 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
20 |
8.36 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
1 |
1.02 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
60 |
15.1 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
25 |
7.09 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
26 |
6.65 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
87 |
41.91 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
34 |
28.25 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
58 |
32.89 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
21 |
6.48 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
6885 |
1807.5 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
8 |
2.42 |
|