Tomato sRNA S25628348
| Sequence | Length | annotation |
| UUGGCUGAGUGAGCAUCACGG | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
24295 |
2367.42 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
8219 |
1089.39 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
5341 |
623.95 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
11178 |
2407.1 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
75224 |
5548.51 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
3508 |
1466.92 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
185 |
189.17 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
3038 |
764.68 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
1741 |
493.44 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
4830 |
1235.71 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1308 |
630.06 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
442 |
367.19 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
387 |
219.43 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1995 |
615.55 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
1146 |
300.86 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
81477 |
24387.2 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
25220 |
7632.62 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
56940 |
17158.4 |
|