Tomato sRNA S26186508
| Sequence | Length | annotation |
| UUUCGGACCAGGCUUCAUUCCC | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
66 |
14.21 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
697 |
51.41 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
68 |
52.4 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
27 |
20.48 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
9 |
6.41 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
26 |
19.15 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
40 |
24.98 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
31 |
19.75 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
36 |
23.73 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
33 |
20.17 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
37 |
22.15 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
13 |
12.68 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
28 |
16.35 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
17 |
16.68 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
23 |
16.27 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
44 |
47.9 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
29 |
27.71 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
15 |
43.33 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
26 |
18.11 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
46 |
61.38 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
22 |
9.2 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
3 |
3.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
33 |
8.31 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
1 |
0.28 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
25 |
6.4 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
8 |
3.85 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2 |
1.66 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
20 |
11.34 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
695 |
214.44 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
75 |
19.69 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
38 |
11.37 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
357 |
108.04 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
25 |
7.53 |
|