Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUUGGACGGCAUGAACACUAAUGU	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	9	0.88
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	6	0.8
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	6	1.29
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	23	1.7
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	417	174.37
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	778	795.54
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	466	117.29
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	1429	405.01
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	678	173.46
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	206	99.23
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	139	115.47
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	228	129.28
S0708	Solanum lycopersicum	MicroTom	flower, open	472	145.63
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	956	250.98
S0371	Solanum lycopersicum	Heinz 1706	leaf	4	1.21