 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00006
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| CUGGCAGAAGAGAGUGAGCA | 20 | miR156 | S14727255 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 33 | 3.22 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 76 | 10.07 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 8 | 0.93 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1712 | 126.28 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 408 | 314.41 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 516 | 391.44 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 924 | 658.29 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 1226 | 902.92 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 434 | 270.99 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 274 | 174.55 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 886 | 583.92 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 750 | 458.51 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 701 | 419.63 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 112 | 109.28 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 159 | 92.82 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 50 | 49.05 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 268 | 189.54 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 52 | 56.61 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1 | 0.96 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 77 | 53.64 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 320 | 427.02 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1713 | 716.31 |
| S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 257 | 262.8 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6234 | 1569.13 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 206 | 58.39 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 387 | 99.01 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 118 | 56.84 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 94 | 78.09 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 109 | 61.8 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 178 | 54.92 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 509 | 133.63 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 461 | 137.98 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 378 | 114.4 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2759 | 831.4 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|---|
| cme-miR156j | -CTGGCAGAAGAGAGTGAGCA- xx||x||||||||||||||||x GTTGACAGAAGAGAGTGAGCAC |
| gma-miR156k | CTGGCAGAAGAGAGTGAGCA- x||x||||||||||||||||x TTGACAGAAGAGAGTGAGCAC |
| gma-miR156n | CTGGCAGAAGAGAGTGAGCA- x||x||||||||||||||||x TTGACAGAAGAGAGTGAGCAC |
| gma-miR156o | CTGGCAGAAGAGAGTGAGCA- x||x||||||||||||||||x TTGACAGAAGAGAGTGAGCAC |
Precursor of miRNA M00006
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch12 | 3275456 | 3275349 | - | CUGGCAGAAGAGAGUGAGCA UACACAUAUAAUUAUAUAAA CAUGUUUACAUAAUUCUUUU GAUAUAUAUAUAUAUAAUUU UGCGUGUGCUCACUUCUCUU UCUGUCAA |
-40.30 | NA | structure |
