Tomato sRNA S14727255
| Sequence | Length | annotation |
| CUGGCAGAAGAGAGUGAGCA | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
33 |
3.22 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
76 |
10.07 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
8 |
0.93 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1712 |
126.28 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
408 |
314.41 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
516 |
391.44 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
924 |
658.29 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
1226 |
902.92 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
434 |
270.99 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
274 |
174.55 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
886 |
583.92 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
750 |
458.51 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
701 |
419.63 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
112 |
109.28 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
159 |
92.82 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
50 |
49.05 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
268 |
189.54 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
52 |
56.61 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
1 |
0.96 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
77 |
53.64 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
320 |
427.02 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1713 |
716.31 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
257 |
262.8 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
6234 |
1569.13 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
206 |
58.39 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
387 |
99.01 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
118 |
56.84 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
94 |
78.09 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
109 |
61.8 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
178 |
54.92 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
509 |
133.63 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
461 |
137.98 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
378 |
114.4 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2759 |
831.4 |
|