 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00038
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| UGAAGCUGCCAGCAUGAUCUAA | 22 | miR167 | S23003516 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 6 | 0.58 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 5 | 0.66 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 25 | 2.92 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 11 | 2.37 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 10411 | 767.91 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 603 | 464.68 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 449 | 340.61 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 455 | 324.16 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 279 | 205.48 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 430 | 268.49 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 248 | 157.99 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 302 | 199.03 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 249 | 152.23 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 326 | 195.15 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 591 | 576.64 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 749 | 437.25 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 637 | 624.86 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 630 | 445.56 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 560 | 609.62 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 708 | 676.46 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 137 | 395.76 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 400 | 278.66 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 188 | 250.87 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 5 | 2.09 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 22 | 5.54 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 66 | 16.89 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 16 | 7.71 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 44 | 24.95 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 1312 | 404.81 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 472 | 123.91 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 7 | 2.1 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1065 | 322.31 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 727 | 219.08 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|---|
| bna-miR167a | TGAAGCTGCCAGCATGATCTAA |||||||||||||||||||||| TGAAGCTGCCAGCATGATCTAA |
| bna-miR167b | TGAAGCTGCCAGCATGATCTAA |||||||||||||||||||||| TGAAGCTGCCAGCATGATCTAA |
Precursor of miRNA M00038
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch09 | 59575910 | 59575990 | + | UGAAGCUGCCAGCAUGAUCU AAACUUGGCCAUUUAUAAAG AAAAUGGGUGACUAAGGUUA GGUCAUGCUCGGACAGCCUC A |
-38.00 | NA | structure |
