Tomato sRNA S23003516
| Sequence | Length | annotation |
| UGAAGCUGCCAGCAUGAUCUAA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
6 |
0.58 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
5 |
0.66 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
25 |
2.92 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
11 |
2.37 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
10411 |
767.91 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
603 |
464.68 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
449 |
340.61 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
455 |
324.16 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
279 |
205.48 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
430 |
268.49 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
248 |
157.99 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
302 |
199.03 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
249 |
152.23 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
326 |
195.15 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
591 |
576.64 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
749 |
437.25 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
637 |
624.86 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
630 |
445.56 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
560 |
609.62 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
708 |
676.46 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
137 |
395.76 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
400 |
278.66 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
188 |
250.87 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
5 |
2.09 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
22 |
5.54 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
66 |
16.89 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
16 |
7.71 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
44 |
24.95 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
1312 |
404.81 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
472 |
123.91 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
7 |
2.1 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1065 |
322.31 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
727 |
219.08 |
|