TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00062

sequenceLengthmiRNA familysRNA IDtarget
GUUCAAUAAAGCUGUGGGAAG21miR396 S19864877click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 6302 614.1
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 7295 966.92
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 37715 4405.95
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 9850 2121.13
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 62 4.57
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 241 185.72
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 291 220.75
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 139 99.03
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 331 243.77
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 577 360.28
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 131 83.45
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 417 274.82
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 278 169.95
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 174 104.16
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 150 146.36
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 254 148.28
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 203 199.13
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 122 86.28
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 623 678.2
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 277 264.66
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 128 369.76
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 168 117.04
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 104 138.78
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 24 10.04
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 6 6.14
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 120 30.2
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 34 9.64
S0712 Solanum lycopersicum MicroTom fruit , mature green 213 54.49
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 971 467.73
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 274 227.62
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 13 7.37
S0708 Solanum lycopersicum MicroTom flower, open 97 29.93
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 116 30.45
S0373 Solanum lycopersicum Heinz 1706 fruit 310 92.79
S0372 Solanum lycopersicum Heinz 1706 flower 300 90.79
S0371 Solanum lycopersicum Heinz 1706 leaf 237 71.42

Hits on known miRNAs

hit miRNAalignment
aly-miR396a-3pGTTCAATAAAGCTGTGGGAAG
|||||||||||||||||||||
GTTCAATAAAGCTGTGGGAAG
gma-miR396i-3pGTTCAATAAAGCTGTGGGAAG
|||||||||||||||||||||
GTTCAATAAAGCTGTGGGAAG

Precursor of miRNA M00062

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch00 12537518 12537619 + UUUUCCACAGCUUUCUUGAA
CUGCAUCUACAAUUUCAAUU
CAUUAUUGAAAAAGAAAAAA
UUGAUUCAUAUUGUUGUUGC
GGUUCAAUAAAGCUGUGGGA
AG		 -42.20 NA structure
SL2.40ch12 2905792 2905659 - UUUUCCACAGCUUUCUUGAA
CUGCAUACAUAUAACAAAAA
AAUCUGAUUUUUUUUUGAUU
UUUUUUUACUUUUAUAAAGA
AAAAAUUUAGAUGGAAAGAA
UUAAAUUGUUGCGGUUCAAU
AAAGCUGUGGGAAG		 -44.10 NA structure