Tomato sRNA S19864877
| Sequence | Length | annotation |
| GUUCAAUAAAGCUGUGGGAAG | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
6302 |
614.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
7295 |
966.92 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
37715 |
4405.95 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
9850 |
2121.13 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
62 |
4.57 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
241 |
185.72 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
291 |
220.75 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
139 |
99.03 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
331 |
243.77 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
577 |
360.28 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
131 |
83.45 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
417 |
274.82 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
278 |
169.95 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
174 |
104.16 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
150 |
146.36 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
254 |
148.28 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
203 |
199.13 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
122 |
86.28 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
623 |
678.2 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
277 |
264.66 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
128 |
369.76 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
168 |
117.04 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
104 |
138.78 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
24 |
10.04 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
6 |
6.14 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
120 |
30.2 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
34 |
9.64 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
213 |
54.49 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
971 |
467.73 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
274 |
227.62 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
13 |
7.37 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
97 |
29.93 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
116 |
30.45 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
310 |
92.79 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
300 |
90.79 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
237 |
71.42 |
|