TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00067

sequenceLengthmiRNA familysRNA IDtarget
ACGCAGGAGAGAUGAUGCUGGA22miR4376 S05138366NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 23 2.24
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 230 30.49
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 36 4.21
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 7 1.51
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 6411 472.87
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 13 5.44
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 27 6.8
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 22 6.24
S0712 Solanum lycopersicum MicroTom fruit , mature green 189 48.35
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 52 25.05
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 17 14.12
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 103 58.4
S0708 Solanum lycopersicum MicroTom flower, open 737 227.4
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 854 224.2
S0373 Solanum lycopersicum Heinz 1706 fruit 369 110.45
S0372 Solanum lycopersicum Heinz 1706 flower 1043 315.66
S0371 Solanum lycopersicum Heinz 1706 leaf 3791 1142.39

Hits on known miRNAs

hit miRNAalignment
sly-miR4376ACGCAGGAGAGATGATGCTGGA
||||||||||||||||||||||
ACGCAGGAGAGATGATGCTGGA

Precursor of miRNA M00067

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch06 4541890 4541961 + ACGCAGGAGAGAUGAUGCUG
GACGAUAGAGAAAAUGGGAU
UUAAUUUAUUGGCCAGCAUC
AUACUCCUGCAU		 -36.50 NA structure