Tomato sRNA S05138366
| Sequence | Length | annotation |
|---|
| ACGCAGGAGAGAUGAUGCUGGA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
23 |
2.24 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
230 |
30.49 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
36 |
4.21 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
7 |
1.51 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
6411 |
472.87 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
13 |
5.44 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
27 |
6.8 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
22 |
6.24 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
189 |
48.35 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
52 |
25.05 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
17 |
14.12 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
103 |
58.4 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
737 |
227.4 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
854 |
224.2 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
369 |
110.45 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1043 |
315.66 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
3791 |
1142.39 |
|
